rocG [2018-02-13T10:17:47.000Z]

trigger enzyme, glutamate dehydrogenase and effector protein for GltC

Locus: BSU37790

Isoelectric point: 6.28

Molecular weight: 46.48 kDa

Protein length: 424 aa

Gene length: 1272 bp

Function: arginine utilization, controls the activity of GltC

Product: glutamate dehydrogenase

Essential: no

E.C.: 1.4.1.2

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of glutamine/ glutamate
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of arginine/ ornithine
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Information processing → Regulation of gene expression → Trigger enzyme → Trigger enzymes that control gene expression by protein-protein interaction with transcription factors

Gene

Coordinates: 3,880,740 → 3,882,014

Phenotypes of a mutant

• Poor growth on complex media such as SP (sporulation medium). No growth in minimal media with arginine as the only carbon source. Rapid accumulation of suppressor mutants (gudB1]])
• sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin (suppressed by activation of gudB) due to the downregulation of the SigW regulon PubMed
• transcription profile of a rocG gudB mutant strain: GEO PubMed

The protein

Catalyzed reaction/ biological activity

• L-glutamate + H₂O + NAD⁺ = 2-oxoglutarate + NH₃ + NADH + H⁺ (according to Swiss-Prot), controls the activity of the GltC transcription activator PubMed

Protein family

• Glu/Leu/Phe/Val dehydrogenases family (according to Swiss-Prot)

Paralogous protein(s)

• GudB

Kinetic information

• K_M [glutamate] = 2.9 mM, K_M [ammonium] = 18 mM PubMed

Cofactors

• NAD⁺/NADH + H⁺

Structure

• 3K92 (super-repressor mutant that is capable of constitutive inactivation of GltC, E93K mutation) PubMed

Expression and Regulation

Operons

• Genes: rocG
  Description: PubMed

  Sigma factors

  • SigL: sigma factor, PubMed, in SigL regulon

  Regulatory mechanism

  • RocR: activation, PubMed, in RocR regulon
  • AhrC: activation, PubMed, in AhrC regulon
  • CcpA: repression, PubMed, in CcpA regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Additional information

  • Activation by RocR requires binding of RocR to a downstream element PubMed

Biological materials

Mutant

• GP747 (spc), GP726 (aphA3), GP810 (del tet), GP1157 (cat) all available in Jörg Stülke's lab
• BKE37790 (ΔrocG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
• BKK37790 (ΔrocG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA

Expression vector

• expression of native rocG in B. subtilis: pGP529 (in pBQ200), available in Jörg Stülke's lab PubMed
• for purification of RocG from E. coli carrying an N-terminal Strep-tag: pGP902 (in pGP172), a series of rocG variants is also available in pGP172, available in Jörg Stülke's lab
• for expression/ purification from E. coli with N-terminal His-tag and thrombin cleavage site, in pWH844: pGP860, available in Jörg Stülke's lab
• purification from B. subtilis with an N-terminal Strep-tag, for SPINE, (in pGP380): pGP1709, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Jörg Stülke, University of Göttingen, Germany
• Homepage
• Fabian Commichau University of Göttingen, Germany
• Homepage

References

Reviews

Loading

Enzymatic activity of RocG

Loading

Function in the control of GltC activity

Loading

Expression of rocG

Loading

Structural analysis of glutamate dehydrogenase

Loading

Bypass of rocG mutations

Loading

Additional publications

Loading